Q&A - Ask Doubts and Get Answers
Q

If the sequence of one strand of DNA is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3'

3. If the sequence of one strand of DNA is written as follows:
    5'-ATGCATGCATGCATGCATGCATGCATGC-3'

    Write down the sequence of complementary strand in 5'\rightarrow 3' direction.

Answers (1)
Views
S Sonika

With regard to base pairs the DNA strand are complementary to each other. So, if the sequence of DNA is

  5'-ATGCATGCATGCATGCATGCATGCATGC-3'

The sequence of the complementary strand will be 

3`- TACGTACGTACGTACGTACGTACGTACG - 5`.

In 5' - 3' strand, it can be written as

5'- GCATGCATGCATGCATGCATGCATGCAT-3'

Exams
Articles
Questions