Q&A - Ask Doubts and Get Answers

Sort by :
Clear All
Q

14. Briefly describe the following:

     (d) Bioinformatics

Bioinformatics- It is a recent and very effective area in the field of biology. In this discipline, the knowledge from the DNA sequences is used for solving various doubt regarding organisms which can not be studied on them in real time. Therefore, we can say that we utilise the biological information stored in the DNA of an organism.

14. Briefly describe the following:

     (c) Translation
   

Translation- The process of polymerisation of amino acids into a polypeptide chain is referred to as translation. The order and sequence of amino acids in a polypeptide chain is dependent upon the base sequence of mRNA. Process of translation involves three steps i.e. initiation, elongation and termination. During the initiation, the ribosome binds to the mRNA at the start codon which is AUG....

14. Briefly describe the following:

              (b) Polymorphism
            

Polymorphism- It refers to a special kind of genetic variation in which nucleotide sequence can exist at a particular site in a  DNA molecule. This heritable mutation is caused due to a mutation in either somatic cell or in the germ cell. It ultimately results in the accumulation of various mutations at one site. Polymorphism brings revolution in the process of finding a location on the...

14. Briefly describe the following:

      (a) Transcription
            

Transcription- It refers to the process of copying genetic information from one strand of DNA into mRNA. In transcription, only one strand is copied into the RNA. While copying, the place of adenine is taken up by uracil. The transcription of DNA includes a transcription unit. The transcription unit is consists of a promoter, the structural gene and a terminator. The strands that have polarity...

13. What is DNA fingerprinting? Mention its application.

DNA fingerprinting is a very easy and quick way to compare the DNA sequence of any two individuals. It includes identifying differences in some specific regions in DNA sequence called as repetitive DNA sequences. In these regions, a small stretch of DNA is repeated many times and they are specific for every individual. The technique of fingerprinting was initially developed by Alec...

12. Why is the Human Genome project called a mega project?

human genome project was called a mega project because it had involved a lot of money most advanced technologies numerous computer many scientist and a long span of time the magnitude of the project can be imagined by visualising  that it was aimed to find out the complete DNA sequence of humans genome which is said to have approximately {3×10}9 base pair the cost of the product can be imagined that if the cost of sequencing a base pair is $3 sequencing of {3×10}9 base pair would be billion dollar further if the data is to be stored in book with each book having 1000 pages and each page is having 1000 letters some 3300 books will be required.

View More

11. Explain (in one or two lines) the function of the followings:

      (c) Exons

Exons are the coding sequences on DNA that transcribe into proteins. 

11. Explain (in one or two lines) the function of the followings:

      (b) tRNA
         

Function of tRNA tRNA plays a major role in the process of protein synthesis. It reads the genetic code present on mRNA.

11. Explain (in one or two lines) the function of the followings:

      (a) Promoter
       

Function of promoter  Promoter gene refers to the site where the RNA polymerase enzyme binds and transcription of mRNA starts. 

10. In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down sometime after addition of lactose in the medium?

Lac operon refers to a segment of DNA which consists of one regulatory gene (i ) and three structural genes (y,z and a). Among the three structural genes, the z gene code for enzyme beta-galactosidase, that is responsible for the hydrolysis of the disaccharide lactose into its monomeric units, galactose and glucose. Gene y code for enzyme permease, which increases the permeability of the cell....

9. List two essential roles of ribosome during translation.

The ribosome is a complex structure made up of ribonucleoproteins. It consists of two subunits i.e. a larger subunit and a smaller subunit. The essential roles of ribosomes during translation are as follows: 1. Ribosome acts as the site of protein synthesis. The larger subunit of ribosome act as an amino acid binding site while small subunit attaches to the mRNA.  2. Ribosome acts as a catalyst...

8. Differentiate between the followings:

    (c) Template strand and Coding strand

Template strand Coding strand It is the template for the synthesis of mRNA during transcription Strand of DNA having the same sequence as mRNA (thymine in DNA is replaced by uracil in RNA Its polarity is 3' to 5' Its polarity is 5' to 3'  

8. Differentiate between the followings:

            (b) mRNA and tRNA
        

mRNA or messenger RNA                                   tRNA or transfer RNA It acts as the template for the translation of proteins.  tRNA acts as the adapter molecule that carries specific amino acid to mRNA for the synthesis of a polypeptide.       

8. Differentiate between the followings:

           (a) Repetitive DNA and Satellite DNA
         

Repetitive DNA Satellite DNA Repetitive DNA refers to DNA sequences containing small segments that are repeated many times  DNA sequences containing highly repetitive DNA.   

7. How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?

Alfred Hershey and Martha Chase (1952) worked with a virus that infects bacteria called bacteriophages. They used different radioactive isotopes to label DNA and protein. In their experiment, in one preparation, the protein part was made radioactive and in the other, nucleic acid (DNA) was made radioactive. These two phage preparations were allowed to infect the culture of E.coli. Soon after...

6. Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid polymerases.

Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), two types of nucleic acid polymerases are found 1. DNA dependent DNA polymerase- It uses a DNA as a template to synthesise new strand of DNA.  2. DNA dependent RNA polymerase- It uses DNA as a template to synthesise RNA. 

5. Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.

The property of DNA double helix which led Watson and Crick to hypothesise semi-conservative mode of DNA replication is that the two strands of DNA are antiparallel and complementary to each other in terms of their base sequences. This arrangement suggests that DNA replication is semiconservative. During replication, the two strands unwind and each strand acts as a template for the synthesis of...

    If the sequence of the coding strand in a transcription unit is written as follows:
           5'-ATGCATGCATGCATGCATGCATGCATGC-3'
           Write down the sequence of mRNA.

The sequence of mRNA is the same as the coding strand of DNA except that thymine is replaced by uracil. Thus, the sequence of mRNA will be 5` - AUGCAUGCAUGCAUGCAUGCAUGCAUGC - 3`.

3. If the sequence of one strand of DNA is written as follows:
    5'-ATGCATGCATGCATGCATGCATGCATGC-3'

    Write down the sequence of complementary strand in 5'\rightarrow 3' direction.

With regard to base pairs the DNA strand are complementary to each other. So, if the sequence of DNA is   5'-ATGCATGCATGCATGCATGCATGCATGC-3' The sequence of the complementary strand will be  3`- TACGTACGTACGTACGTACGTACGTACG - 5`. In 5' - 3' strand, it can be written as 5'- GCATGCATGCATGCATGCATGCATGCAT-3'

2. If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.

By Chargaff's rule, we know that A=T and G=C. Since there are 20% cytosines, so guanines percentage will also be 20%. The G+C count is 20+20= 40%. Therefore, the remaining 60% will be contributed equally by adenine and thymine. Thus, the percentage of adenine and thymine are 30% each.     
Exams
Articles
Questions